Інформація

Проблема мРНК метаглобуліну миші


Це нитка мРНК метаглобуліну миші:

5'-ccccagauacggaauucgaau-3 '

А) Яка маленька РНК (нижче) найбільш імовірно регулює експресію метаглобіну?

  1. 5'-auucgaauuuuauaugggggg-3 '
  2. 5'-ggggucuaucuuuuaagcuua-3 '
  3. 5'-ccccagauacggaauucgaau-3 '
  4. 5'-uaagcuuaaggcauagacccc-3 '

Б) Ця РНК, швидше за все?

  1. діє як сиРНК
  2. пригнічують трансляцію метаглобіну
  3. збільшити трансляцію метаглобіну
  4. допомагають транспортувати мРНК метаглобіну назад у ядро

Моя спроба:

Я думаю, що А дорівнює 2, тому що нитка є комплементарною і добре зв'язується з ланцюгом мРНК. Для B я між 2 і 3, але не можу вирішити.


Винятки завжди є, але ви можете врахувати деякі загальні правила.

A дорівнює 1, тобто послідовність, яка є абсолютно комплементарною (2 комплементарна, але напрямок паралельний - не може спарювати основи), тоді B буде 1 (siРНК). Причини (деякі базуються лише на загальних правилах проектування siRNA):

  • siРНК повинні бути ідеально взаємодоповнюючими
  • Розмір також ідеально підходить для siRNA (21nt)
  • U/A (2-3 залишку) на 5 'сиРНК
  • U на 10 позиції
  • Вміст ГХ 43% (ідеально 30-50%)

Дивіться тут для вказівок щодо проектування siRNA.


Синтетична хімічно модифікована мРНК (модРНК): до нової технологічної платформи для серцево -судинної біології та медицини

За останні два десятиліття було виявлено безліч нових молекулярних шляхів, які керують розвитком і хворобами серця ссавців. Здатність генетично маніпулювати цими шляхами in vivo значною мірою залежала від генерації генно-інженерних модельних систем миші або перенесення екзогенних генів у різних векторах ДНК (плазміди, аденовіруси, аденоасоційовані віруси, антисмислові олігонуклеотиди тощо). . Нещодавно було повідомлено про новий підхід до маніпуляцій з генною програмою серця дорослих ссавців, який швидко дозволить високоефективно експресувати практично будь-який білок у непошкодженому серці миші, щура, свині, нелюдських приматів та клітин серця людини. генерація хімічно модифікованої мРНК (модРНК). Технологічна платформа має важливі наслідки для окреслення специфічних паракринних сигналів, що керують кардіогенезом людини, та шляхів, які можуть викликати регенерацію серця за рахунок швидкої генерації бібліотек модРНК паракринних факторів для прямого введення in vivo. Крім того, стратегію можна поширити на різноманітні інші серцево -судинні тканини та тверді органи у різних видів, а останні вдосконалення основної технології підтримали перехід до перших досліджень модРНК на людях протягом наступних 2 років. Ці останні досягнення розглядаються разом із прогнозами потенційного впливу технології на низку інших біомедичних проблем у серцево -судинній системі.

Авторське право © 2015 Лабораторія Cold Spring Harbour Press усі права захищені.

Цифри

Підходи до маніпулювання молекулярними ...

Підходи до маніпулювання молекулярними шляхами людського серця in vivo. А…

Ендотеліальний фактор росту судин (VEGF)…

МодРНК судинного ендотеліального фактора росту (VEGF) спрямовує високоефективну експресію секретованого VEGF з…

МодРНК VEGFA направляє імпульс ...

МодРНК VEGFA направляє імпульс експресії паракринного фактора in vivo,…

( А. ) Серцева мезодермальна…

( А. ) Мезодермальні попередники серця породжують дві окремі підмножини…


Лейн, К. Д., Марбе, Дж. Та А. Гурдон, Дж. Б. J. molec. Біол. 61, 73–91 (1971).

Хілл, М. та А. Гупперт, Дж. Біохім. біофіз. Acta 312, 26–35 (1970).

Фурусава, М., Нішімура, Т., Ямайдзумі, М. і Амп Окада, Ю. Природа 249, 449–450 (1974).

Loyter, A., Zakai, N. & amp Kulka, R.G. J. Клітинний біол. 66, 292–304 (1975).

Мейєр-Гіньярд, Дж., Мейєр, Е. та А. Монтаньє, Л. Proc. натн. Акад. Наук. США. 69, 1203–1207 (1972).

Грассманн, А. Expl Cell Res. 60, 373–382 (1970).

Стейсі, Д. У. та Амп Олфрі, В. Г. Клітинка 9, 725–732 (1976).

Дмитріадіс, Г. Дж. Лист ФЕБС. 86, 289–293 (1978).

Дмитріадіс, Г. Дж. Нуклеїнові кислоти Res. 5, 1381–1386 (1978).

Mayhew, E., Papahadjopoulos, D., O'Malley, J. A., Carter, W. A. ​​& amp Vail, W. J. Молек. Фармац. 13, 488–495 (1977).

Papahadjopoulos, D., Vail, W. J., Jacobson, K. & amp Poste, G. Біохім. біофіз. Acta 394, 483–491 (1975).

Вайсман, Г. та ін. Proc. натн. Акад. Наук. США. 72, 88–92 (1975).

Гейвуд, С.М. Proc. натн. Акад. Наук. США. 67, 1782–1788 (1970).

Причард П. М., Пікчіано Д. Г., Лейкок, Д. Г. та А. Андерсон, В. Ф. Proc. натн. Акад. Наук. США. 68, 2752–2756 (1971).

Stavnezer, J. & amp Huang, R. C. C. Природа новий Biol. 230, 172 (1971).

Дмитріадіс, Г. Дж. Та А. Георгацос, Дж. Г. Лист ФЕБС. 46, 96–100 (1974).

Дмитріадіс, Г. Дж. Та А. Георгацос, Дж. Г. Нуклеїнові кислоти Res. 2, 1719–1726 (1975).

Крейг, Р. К., Браун, П. А., Гаррісон, О. С., Макілріві, Д. та Кемпбелл, П. Н. Біохімія. Дж. 160, 57–74 (1976).

Лаеммлі, У. К. Природа 227, 680–685 (1970).

Харріс, Р. та Укаєйофо, Е. О. Br. Дж. Гемат. 18, 229–235 (1970).

Аврамей, С. Імунохімія 6, 43–52 (1969).

Тернинк, Т. та Аврамей, С. Лист ФЕБС. 23, 24–28 (1972).

Боннер, У. М. та Ласкі, Р. А. Євро. J. Biochem. 46, 83–88 (1974).


Результати

Вектор експресії антисмислової кДНК зменшив рівень мРНК глобіну в стабільних клітинних лініях MEL

Три стабільні клітинні лінії MEL, названі ES10, ES21 та ES22, були встановлені за допомогою мініконструкції HS2γβ. Ми спостерігали конститутивну експресію генів γ і β глобіну у всіх лініях (Малюнок 1, доріжки 1 та 5), як продемонстровано аналізами захисту РНКази (RPAs). Початкові експерименти з інгібування експресії β -глобіну були проведені з двома антисмисловими олігодезоксинуклеотидами (ОДН), один спрямований у бік шапки гена β -глобіну, а другий - у хвіст, у різних концентраціях. Не було виявлено явного впливу на експресію β -гена (дані не показані). Потім ми протестували вектор експресії pZeoβAS, що містить антисмисловий фрагмент кДНК β -глобіну під контролем промотора SV40 на здатність інгібувати експресію β -глобіну. Цей вектор трансфікували в клітини ES21 для встановлення трьох антисмислових стабільних ліній. З огляду на недостатню ефективність ODN, ми вирішили проаналізувати повнорозмірний фрагмент кДНК β-глобіну, щоб отримати максимальний інгібуючий ефект, хоча існує 74% гомології послідовності між генами γ та β. Ми спостерігали зниження рівня мРНК як для β, так і для γ -глобіну на 14 -й день (Малюнок 1, смуги 2–4) та 28 день (Малюнок 1, смуги 6-8) для всіх трьох антисмислових ліній. Було проаналізовано кілька інших стабільних ліній клітин контролю MEL, включаючи BS211, BS212 та BS213, встановлені з орієнтованим на сенс фрагментом кДНК β -глобіну в клітинах ES21, та лінію негативного контролю pZeo, встановлену з вихідним вектором експресії pZeoSV. Не було значних змін рівня мРНК β або γ глобіну для чотирьох контрольних клітинних ліній (Малюнок 1, доріжки 9–13). Рівень транскрипції РНК, продукованої вектором pZeoβAS, вимірювали за допомогою сенсора β-глобіну з допомогою RPA у різні моменти часу. Антисмислові транскрипти β -глобіну були виявлені до 42 -го дня (дані не наведені), що вказує на те, що промотор SV40 продовжував виробляти антисмислові транскрипти РНК протягом тривалого часу, щоб врахувати пригнічену експресію гена глобіну.

Захисний гель РНКази для стабільних ліній клітин MEL β -глобіну. РНК виділяли з клітин на 14 -й та 28 -й день після трансфекції. Загальну РНК (2 мкг) гібридизували зі зондами, специфічними для актину миші (mActin), β (hβ) людини та γ (hγ) людини (див. Матеріали та методи). Авторадіографія показує закономірність експресії генів hβ, hγ та mActin в експериментальних лініях: ES21 (контроль) та три антисмислові стабільні клітинні лінії ASB211, ASB212 та ASB213 (доріжки 1-8). Було проаналізовано декілька контрольних стабільних ліній, включаючи ES 10 (доріжка 9), встановлений лише плазмідою HS2γβ або у поєднанні з орієнтованим на сенс фрагментом кДНК β -глобіну: BS211, BS212 та BS213 (доріжки 10–12). Лінія негативного контролю була встановлена ​​з вихідною плазмідою pZeo (доріжка 13). Доріжки 14 і 15 містять позитивний та негативний (нетрансфіковані клітини MEL) контроль за використовуваними зондами РНК.

Рівні мРНК як для β, так і для γ -глобіну в трьох антисмислових лініях розраховували як співвідношення до актину миші з поправкою на кількість копій гена. Для антисмислових стабільних ліній ASB211, ASB212 та ASB213 середня кількість копій становила 0,18, 0,15 та 0,15 відповідно та 0,20 для контрольної лінії ES21. Рівні мРНК β та γ глобіну були знижені в середньому на 73,9% та 61,6% (Стор & lt 0,05) відповідно (Таблиця 1 та Малюнок 2) у всіх трьох антисмислових лініях до 14 дня. Відносний рівень β проти мРНК γ глобіну (співвідношення β/γ) зменшилася на 31,8%, що свідчить про те, що зменшення синтезу мРНК β глобіну було більшим, ніж для мРНК γ глобіну (табл. 2). До 21 дня співвідношення β/γ становило 68,1%, що свідчить про те, що з 14 по 21 день відбувалося більш швидке скорочення вироблення мРНК β -глобіну, ніж мРНК γ -глобіну. Подібним чином, на 28 та 35 день і рівень мРНК β та γ -глобіну залишався низьким, але послідовно експресія β -глобіну пригнічувалась у більшій мірі, ніж у γ -глобіну (табл. 1 та 2). Зменшення продукування мРНК β та γ -глобіну за допомогою антисмислових транскриптів РНК досягло приблизно однакових рівнів інгібування 77% на 42 -й день у культурі (Таблиці 1 та 2 Малюнок 2). На основі цих даних ми зробили висновок, що антисмисловий вектор блокує експресію гена γ і β глобіну, але спостерігався більш швидкий вплив на ген β глобіну.

Рівні мРНК глобіну людини в антисмислових стійких лініях β -глобіну. Рівні мРНК глобіну людського β (hβ), γ (hγ) та актину миші (mActin) аналізували за допомогою RPA. Середні рівні мРНК β і γ глобіну для трьох антисмислових ліній ASB211, ASB212 та ASB213 показані як співвідношення до mActin з поправкою на кількість копій гена порівняно з контрольною лінією ES21 (рівень мРНК був нормалізований до 100%). Значення являють собою три -чотири незалежних експерименту зі стандартною похибкою середнього значення, показаного за день 14 до дня 42.

Зменшення біосинтезу β -глобінового ланцюга в антисмислових клітинних лініях β -глобіну MEL

Загальний білок був виділений на 14 день з нетрансфікованих клітин MEL та стабільних ліній ES21, ASB211 та ASB213. Рівень біосинтезу β та γ-глобінового ланцюга аналізували за допомогою високоефективної рідинної хроматографії (ВЕРХ), яка показала піки для β та γ-глобінових ланцюгів у лінії ES21 порівняно з контрольними клітинами MEL, не трансфікованими плазмідою HS2γβ (Малюнок 3а, б) . Трансфекції з вектором pZeoβAS призвели до зменшення піку β -глобіну та збільшення піку γ -глобіну (малюнок 3в). Ми спостерігали зменшення синтезу β -глобінового ланцюга людини на лініях ASB211 та ASB213 на 80% та 73% відповідно (Малюнок 4), проте біосинтез γ -глобінового ланцюга збільшився в середньому на 233% та 802% відповідно у двох антисенсивних лініях. Незважаючи на зниження рівня γ -мРНК на 14 день, біосинтез γ -ланцюга помітно збільшився. Можливим механізмом цього спостереження є зміна швидкості трансляції мРНК γ -глобіну у відповідь на швидке зниження рівня мРНК β -глобіну до 14 дня в антисмислових лініях.

ВЕРХ -трасування для синтезу β та γ -глобінового ланцюга. Загальний білок був виділений на 14 день, і людські β (hβ) та γ (hγ) глобінові ланцюги були кількісно визначені для контролю ES21 (панель b) та антисенсивної лінії ASB211 (панель c) порівняно з контрольними нетрансфікованими клітинами MEL (панель а). Зверніть увагу на зменшення β -глобінових ланцюгів та посилення біосинтезу γ -глобінового ланцюга в антисмисловій лінії ASB211 (панель в) Mα, α -глобінові ланцюги миші β май , миша β основних ланцюгів глобіну.

Синтез глобінового ланцюга в присутності вектора експресії pZeoβAS. Загальний білок був виділений на 14 день. Людські β, γ та мишачі α (Mα) глобінові ланцюги кількісно оцінювали за допомогою ВЕРХ -аналізу. У лініях клітин ASB211 та ASB213 MEL, встановлених з вектором pZeoβAS, порівняно з рівнями γ і β -глобіну в ES21, було знижено ланцюг β глобіну (hβ) та збільшено біосинтез ланцюга γ глобіну (hγ). Біосинтез ланцюга глобіну нормалізували до 100% для контрольної лінії ES21. Дані представляють середні значення для двох незалежних експериментів для кожної стабільної лінії.

Зниження рівня мРНК глобіну в первинних еритроїдних культурах

Антисмисловий вектор експресії β -глобіну, pZeoβAS, трансфікували в мононуклеарні клітини периферичної крові, виділені від нормальних і серповидно -клітинних пацієнтів. RPA проводили для кількісного визначення рівнів мРНК для генів γ і β глобіну у співвідношенні до гліцеральдегід-3-фосфатдегідрогенази (GAPD) через 21 день у культурі. Ми спостерігали збільшення базових мРНК β та γ глобіну для зразків, отриманих від пацієнтів із серпоподібними клітинами, порівняно з нормальними суб’єктами (Малюнок 5а, доріжки 1 та 3). Це може бути пов'язано із збільшенням активності кісткового мозку та більшою кількістю ранніх клітин -попередників у зразках серпоподібних клітин, які спостерігали інші дослідники.21 Подібно до того, що спостерігалося у антисмислових стійких лініях клітин MEL, рівень мРНК глобіну зменшився у еритроїдних попередниках, трансфікованих pZeoβAS (Малюнок 5а, смуги 2 та 4). Порівняно з контрольними культурами (еритроїдні попередники, трансфіковані вихідною плазмідою pZeoSV), продукція мРНК β та γ глобіну знизилася в середньому на 83% та 67% (Стор & lt 0,05), відповідно, як для нормальних, так і для серпоподібних еритроїдних попередників (Малюнок 5b, в). Крім того, співвідношення β/γ мРНК зменшилося на 63% для нормальних і на 77% для серпоподібних попередників, що свідчить про те, що зменшення синтезу мРНК β глобіну було значно більшим, ніж у γ глобіну, результат, подібний до того, що спостерігався для стабільних ліній клітин MEL . Більш того, нормальні антисмислові РНК -транскрипти β -глобіну, вироблені pZeoβAS, інгібували мутантний ген β s -глобіну у зразках, отриманих від пацієнтів із серпоподібними клітинами.

Рівні мРНК глобіну в первинних еритроїдних культурах, оброблених антисмисловими транскриптами РНК. Одноядерні клітини периферичної крові трансфікували векторами pZeoβAS або pZeoSV, використовуючи підхід ліпофекції. Негативним контролем служив вектор pZeoSV. NZ, нормальні предки з pZeoSV NA, нормальні предки з pZeoβAS SZ, серпоподібні предки з pZeoSV SA, серпоподібні предки з pZeoβAS. Репрезентативний гель RPA з одного з чотирьох випробуваних зразків показаний на панелі а. Ми спостерігали зменшення інтенсивності сигналу β та γ глобіну для зразків нормальної та серповидної клітин (доріжки 2 та 4). Дані кількісного фосфоризованого пристрою наведені на панелях b і c. І рівні β (hβ), і γ (hγ) глобіну були нормалізовані до 100% для контрольних експериментів з вектором pZeoSV (NZ та SZ). Зверніть увагу на більш значне зниження рівня мРНК β -глобіну порівняно з γ -глобіном як для нормальних, так і для серповидно -клітинних зразків.


Обговорення

Ми розробили байєсівський метод під назвою DecontX, щоб оцінити відсоток перехресного забруднення в кожній клітині через зовнішню РНК або інші експериментальні фактори. У нашій моделі кожна клітина розглядається як суміш мультиноміальних розподілів по генах, одна з її нативних клітинних популяцій, а інша від зараження. Для кожної клітинної популяції розподіл забруднення визначається як комбінація кількості генів інших популяцій клітин. Гени, які мають більш високу експресію (тобто мають більшу кількість UMI) в інших популяціях клітин, швидше за все сприятимуть зараженню в поточній популяції клітин. Отже, ці гени матимуть відносно вищі ймовірності в розподілі забруднення порівняно з розподілом експресії в популяції нативних клітин, і кількість цих генів, швидше за все, буде називатися “зараженням”. Деякі типи генів домашнього господарства, такі як гени, що кодують рибосомний білок, можуть бути високо експресовані у багатьох популяціях клітин і, отже, матимуть високу ймовірність появи як у популяціях природних клітин, так і в розподілах забруднення. У цьому випадку кількість цих генів переважно називатиметься "нативною", якщо припустити, що загальна частка оціненого забруднення в цій клітині також відносно низька. Ми продемонстрували точність DecontX, показавши, що він може точно оцінити відсоток екзогенних, забруднюючих транскриптів у наборі даних суміші миша-людина. Крім того, після оцінки та видалення заражених транскриптів у даних 4K PBMC, профілі генів ключових маркерів для кожної субпопуляції краще нагадували профілі з відсортованих очищених PBMC.

Ми помітили, що типи клітин з більшим загальним вмістом мРНК і поширеністю в наборі даних, швидше за все, сприяють забрудненню в інших типах клітин. Наприклад, у наборі даних суміші людина-миша людські клітини мали більш унікальне вирівнювання UMI в середньому, ніж клітини миші. Таким чином, клітини людини сприяли більшому зчитуванню навколишньої РНК і призводили до більшого забруднення клітин миші. У даних 4K PBMC моноцити були другим за поширеністю типом клітин і мали середню найбільшу загальну кількість UMI. Крім того, асоційовані з моноцитами гени, такі як LYZ, S100A8 та S100A9, були найбільш високоекспресованими генами-маркерами, специфічними для клітинного типу, і таким чином сприяли більшому забрудненню в інших типах клітин порівняно з маркерами інших популяцій. Ці результати показують, що розподіл забруднення в кожній клітині буде залежати від інших типів клітин у аналізі, а також від рівня експресії специфічних генів у цих типах клітин.

У деяких випадках DecontX не зміг повністю видалити аберрантну експресію маркерів типу клітин. Наприклад, 43,03% NK -клітин у 4K PBMC все ще виявляли експресію Т -клітинних маркерів. Одне з можливих пояснень полягає в тому, що деякі клітини в цьому наборі даних були насправді клітинами NKT і дійсно поділяли ознаки експресії як з популяцій NK, так і T -клітин [19]. Іншим фактором є те, що для клітинних популяцій, які мають істотну схожість у моделях експресії генів, DecontX, як правило, буде консервативним і розглядатиме більшість цих показників як нативну експресію, а не як забруднення. Загалом, ми вважаємо, що така поведінка бажана, тому справжні біологічні відмінності між типами клітин не усуваються. Клітини, за оцінками, сильно забруднені DecontX у 4K PBMC, також були оцінені як дублети за незалежними алгоритмами. Тому високі рівні забруднення також можуть бути корисними як критерій контролю якості для виключення клітин. Крім того, оцінка DecontX на наборах базових даних показує, що 10X хром має найменше забруднення, тоді як CEL-seq2 має найбільше забруднення. CEL-seq2 показав набагато вищі частоти інтронічних та міжгенних відображень порівняно з іншими методами scRNA-seq [20]. Хоча протокол SORT-seq схожий на CEL-seq2, він використовував масло, що витікає з пари, для запобігання випаровуванню [7], що призвело до зменшення загального забруднення в нашому аналізі.

Використовуючи вихідні підрахунки для оцінки мультиноміальних розподілів, DecontX усуває потенційну мінливість, яку можна запровадити різними методами нормалізації. Одним обмеженням є те, що мітки кластерних клітин потрібні апріорі. Хоча ми автоматично використовуємо Celda для ідентифікації клітинних кластерів, якщо їх немає, можна використовувати будь -який підхід до швидкого кластеризації клітин. Оскільки розподіл забруднення для кожної популяції клітин походить від усіх інших популяцій, наявних у наборі даних, іноді може бути краще використовувати більш широкі мітки популяції клітин. Наприклад, включення всіх Т-клітин в один кластер, а не обробка окремої субпопуляції Т-клітин як окремого підгрупи може допомогти полегшити кількість Т-клітин, специфічних для розрахунку розподілу забруднення для всіх Т-клітин.


Детальний опис

Миші Ai140D містять умовний алель TIGRE-Ins-TRE2-LSL-EGFP-Ins-CAG-LSL-tTA2, розроблений з промотором TRE2, loxP-фланкована касета STOP і послідовність EGFP, а потім промотор CAG, lox2272-фланкована касета STOP і послідовність tTA2. До експозиції рекомбінази Cre цей алель розроблений для того, щоб мати дві касети з флоксированним STOP, що запобігають експресії генів, що йдуть вниз (EGFP і tTA2). При розведенні на мишах, що експресують Cre рекомбіназу, в результаті потомства будуть видалені обидві касети з флоксированним стопом cre-експресуючі клітини/тканини - що призводить до флуоресценції EGFP та експресії ttA2. Через його розміщення нижче за течією промотору TRE2, подальше введення тетрацикліну (або його аналога доксицикліну [dox]) зменшить/усуне експресію EGFP.

Зокрема, у звітах дослідника -донора за відсутності Cre миші, гетерозиготні щодо Ai140D, не виявляють флуоресценції, є життєздатними та фертильними без жодних повідомлень про грубі фізичні чи поведінкові аномалії. Імунофарбування проти GFP виявляє деяку фонову експресію в корі та гіпокампі, але це в кілька разів менше, ніж рівні, що спостерігаються після впливу Cre рекомбінази. Станом на вересень 2018 року, згідно з досвідом лабораторії Джексона, гомозиготні миші життєздатні та фертильні.
Коли мишей Ai140D розводять за допомогою ліній Cre-драйвера для створення подвійних трансгенних тварин (EGFP+tTA2+/Cre+), клітини, що експресують і tTA2, і Cre, демонструють міцну/яскраву флуоресценцію EGFP. Охарактеризовано послаблення експресії EGFP, спричинене доксами - флуоресценція EGFP повністю пригнічується після двох тижнів лікування доксом.
Кілька лінійок Cre-драйвера зі специфічними моделями експресії були використані з Ai140D, що призвело до появи подвійного мутантного потомства без проблем з життєздатністю (включаючи C57BL/6J-вроджені Etv1-CreERT2 та Sst-IRES-Cre (див. Запаси № 013048 та 013044). Однак подвійні гетерозиготні миші Emx1-IRES-CreAi140D зменшують об’єм мозку та виражену нейродегенерацію у всіх підполях гіпокампа (див. Запас № 005628). Крім того, їх досвід-подвійні гетерозиготні миші Gad2-CreAi140D, що демонструють ембріональну летальність (див. Запас № 019022 ) - це схоже на їхнє виявлення подвійної гетерозиготної летальності за допомогою того самого драйвера Gad2 -Cre з алелем Ai139D або Ai148D (запаси №030219 або 030328).

На сьогоднішній день (березень 2017 р.) Дослідник-донор не оцінював експресію Ai140D, індуковану Cre, в інших тканинах, крім мозку.


FDA схвалює перший тест CRISPR для виправлення генетичних дефектів, що викликають серповидноклітинні захворювання

У 2014 році, через два роки після її винахідника, лауреата Нобелівської премії редагування генома CRISPR-Cas9, Дженніфер Дудна вважала, що ця технологія є достатньо зрілою, щоб впоратися з ліками від руйнівної спадкової хвороби, серповидно-клітинної хвороби, від якої страждають мільйони людей у ​​всьому світі, більшість з них африканського походження. Близько 100 000 чорношкірих людей у ​​США страждають на цю хворобу.

Мобілізуючи колег у новому на той час Інституті інноваційного геному (IGI)-спільному дослідницькому співробітництві між Каліфорнійським університетом, Берклі та Каліфорнійським університетом Сан-Франциско-вони прагнули відновити єдину мутацію, яка змушує червоні кров’яні тільця деформуватися і закупорювати артерії, викликаючи страшенні муки біль і часто смерть. Доступне сьогодні лікування зазвичай передбачає регулярне переливання крові, хоча трансплантація кісткового мозку може вилікувати тих, хто може знайти відповідного донора.

Після шести років роботи ця експериментальна терапія була схвалена для клінічних випробувань Управлінням з контролю за продуктами та лікарськими засобами США, що дозволило першим випробуванням на людях терапії на основі CRISPR безпосередньо виправити мутацію гена бета-глобіну, відповідального за серп клітинна хвороба. Бета-глобін-один з білків гемоглобінового комплексу, що відповідає за перенесення кисню по всьому організму.

Випробування, які, як очікується, триватимуть чотири роки, будуть проводити лікарі з дитячої лікарні UCSF Benioff Oakland та Дослідницького центру широких стовбурових клітин UCLA, які планують розпочати цього літа для зарахування шести дорослих та трьох підлітків з важкою серповидно -клітинною хворобою.

Лабораторія клінічної діагностики IGI, яка була побудована під керівництвом Дудни для забезпечення безкоштовного тестування на COVID-19 для спільноти Берклі, відіграватиме ключову роль в аналітичній підтримці дослідження шляхом розробки діагностики для моніторингу добробуту пацієнтів та відстеження ефективності лікування.

"Ми мотивовані працювати над лікуванням, яке може бути доступним і доступним для пацієнтів у всьому світі", - сказала Дудна, професор молекулярної та клітинної біології та хімії з Каліфорнійського університету в Берклі та дослідник Медичного інституту Говарда Х'юза. "Початок цього випробування є важливим першим кроком на цьому шляху".

Доктор Марк Уолтерс, професор педіатрії в UCSF і директор сім'ї Йорданії з програми трансплантації крові та кісткового мозку в дитячій лікарні UCSF Benioff Oakland, очолює клінічні випробування. (Фото надано UCSF)

Інші випробування успішно використовували CRISPR-Cas9 для вилучення гена, який пригнічує ген гемоглобіну плода, який зазвичай вимикається у людини. Ця методика знову пробуджує ген плода і, принаймні у трьох пацієнтів, полегшує симптоми серповидноклітинної хвороби.

Нове випробування є новим геном: Дослідники використовують CRISPR-Cas9, щоб замінити дефектний ген бета-глобіну на відремонтовану версію, з метою створення нормальних, дорослих еритроцитів крові та лікування хвороби.

"Ця терапія має потенціал для трансформації лікування серповидно -клітинної хвороби шляхом створення доступного, цілющого лікування, яке є більш безпечним, ніж поточна терапія трансплантації стовбурових клітин від донора кісткового мозку", - сказав доктор Марк Уолтерс, професор педіатрії з UCSF та головний дослідник проекту клінічних випробувань та редагування генів. "Якщо це успішно застосовується у маленьких пацієнтів, це має потенціал для запобігання незворотним ускладненням хвороби".

Ще одне клінічне випробування, яке також використовує CRISPR для прямої корекції мутації серповидно -клітинних клітин, але з дещо іншим підходом, планується розпочати цього року під керівництвом Graphite Bio на основі досліджень лабораторії Метью Портеуса ’ у Стенфордському університеті.

Пацієнти є власними донорами стовбурових клітин

Ця техніка, як і альтернативний підхід, який відновлює гемоглобін плоду, вимагає, щоб деякі гемопоетичні стовбурові клітини пацієнта - клітини кісткового мозку, які виробляють усі еритроцити організму - збирали для редагування генів поза організмом. Після видалення цих клітин кістковий мозок, що залишився, руйнується за допомогою хіміотерапії, що дає простір для відновлених та реінфузованих стовбурових клітин.

Доктор Дональд Кон, видатний професор мікробіології, імунології та молекулярної генетики, педіатрії та молекулярної та медичної фармакології в Медичній школі імені Девіда ffеффана в Каліфорнійському університеті та член Центру досліджень широких стовбурових клітин UCLA, бере участь у різних випробуваннях генної терапії для таких захворювань, як SCID та серповидноклітинна хвороба. (Фото надано UCLA)

Уолтерс, який також є Джорданським сімейним директором програми трансплантації крові та кісткового мозку в дитячій лікарні UCSF Benioff Oakland, буде співпрацювати з лікарем-вченим з Каліфорнійського університету, доктором Дональдом Кон, який розробив генну терапію для кількох генетичних порушень крові, включаючи лікування для форми важкого комбінованого імунодефіциту (SCID). Кон також веде клінічне випробування іншого типу генної терапії серповидно -клітинної хвороби, яке передбачає додавання нового гена до стовбурових клітин пацієнтів для подолання мутації серповидно -клітинної клітини.

"Генна терапія та редагування генів дозволяють кожному пацієнту служити своїм власним донором стовбурових клітин", - сказав Кон, видатний професор мікробіології, імунології та молекулярної генетики, педіатрії та молекулярної та медичної фармакології в Медичній школі імені Девіда ffеффана в Каліфорнійському університеті та член Центру досліджень широких стовбурових клітин UCLA. "Теоретично ці підходи повинні бути набагато безпечнішими, ніж трансплантація від іншої людини, і можуть стати загальнодоступними, оскільки вони усувають необхідність знаходити голку в стозі сіна, що є донором стовбурових клітин".

Кон керуватиме лабораторними та клінічними випробуваннями в Каліфорнійському університеті та контролюватиме все виробництво лікарського засобу під назвою CRISPR_SCD001 для клінічного випробування. Доклінічна робота з розробки цієї терапії фінансувалася Каліфорнійським інститутом регенеративної медицини, Національною ініціативою клітин серповидно-кліткового серця під керівництвом Інституту серця, легенів та крові та Благодійним фондом Доріс Дюк.

Федір Урнов, директор з технологій та перекладу IGI та професор молекулярної та клітинної біології з Берклі, контролюватиме біоінформатику та геноміку для дослідження.

"Примітно, що це нове випробування надходить від консорціуму некомерційних академічних установ, які мають стимул з довгостроковим баченням вилікувати хворобу за доступним рішенням, яке може принести глобальну користь усім, хто цього потребує",-сказав Урнов.

Федір Урнов, директор з технологій та перекладу IGI, буде контролювати діяльність з біоінформатики та геноміки для клінічних випробувань. (Фото Keegan Houser)

Серповидноклітинна хвороба викликана однією зміною коду ДНК гена бета-глобіну. У новому дослідженні використовується нуклеаза CRISPR-Cas9-повністю зібраний білок Cas9 та провідна РНК-послідовність, спрямована на дефектну область гена бета-глобіну, що супроводжується коротким сегментом ДНК, що кодує належну послідовність,-для стимулювання відновлення серповидної мутації шляхом заміни нормальний сегмент ДНК для аномального. При такому підході пацієнта стовбурові клітини крові спочатку обробляють електричними імпульсами, які створюють пори в їх мембранах. Ці пори дозволяють платформі CRISPR-Cas9 проникати в стовбурові клітини і подорожувати до їх ядер, щоб виправити мутацію серповидноклітинних клітин.

"Мета цієї форми терапії редагування генома-виправити мутацію у достатній кількості стовбурових клітин, щоб результуюча кров у циркуляції виправила еритроцити",-сказав Уолтерс. "Виходячи з нашого досвіду трансплантації кісткового мозку, ми прогнозуємо, що корекція 20% генів повинна бути достатньою для того, щоб перевершити рідні серпові клітини і мати сильну клінічну користь".

Остаточний протокол виробництва використовує безвірусний метод для редагування стовбурових клітин крові і був підтверджений у доклінічних дослідженнях безпеки/токсикології, проведених після консультації з FDA.

Майбутня терапія CRISPR

У той час як лікарі UC беруть поточну терапію CRISPR у клінічні випробування, вчені IGI працюють над вдосконаленням техніки, щоб врешті -решт корекцію мутації серповидно -клітинної тканини можна було здійснити всередині організму, не видаляючи стовбурові клітини або руйнуючи кістковий мозок. Оскільки кістковий мозок також виробляє білі кров’яні тільця, які захищають нас від хвороб, його руйнування гальмує імунну систему і наражає пацієнтів на підвищений ризик зараження або навіть раку, поки введені, виправлені стовбурові клітини не зможуть розмножуватися і поповнюватися.

Серповидно-клітинна хвороба викликана мутацією гена бета-глобіну, що змушує еритроцити деформуватися у форму серпа (на передньому плані) у порівнянні з нормальною круговою формою, що спостерігається на задньому плані. Серповидні клітини закупорюють артерії, що призводить до інтенсивного болю та пошкодження органів. (Зображення надано Інститутом інноваційної геноміки, Каліфорнійський університет Берклі)

"На даний момент ми проводимо терапію ex vivo, де ви виймаєте клітини з кісткового мозку, щоб виправити мутацію поза організмом", - сказав Росс Вілсон, директор відділу терапії IGI ’. “ Але за цей час - це можуть бути місяці - кістковий мозок наповнюється. В результаті, коли настає час для введення виправлених клітин, пацієнта необхідно піддати агресивній хіміотерапії, яка очищає кістковий мозок і дозволяє цим виправленим клітинам знайти будинок. ”

Уілсон оптимістично вважає, що він та вчені IGI можуть знайти спосіб направити терапію CRISPR безпосередньо до кісткового мозку всередині організму, використовуючи антитіла для націлювання ферменту CRISPR на правильні стовбурові клітини. Інші вчені, які використовують інженерні віруси або жирові краплі - наночастинки ліпідів - для перенесення ферменту CRISPR в організм, поки що зазнали невдачі.

“Молекула, яку ми намагаємося доставити, фізично менша - восьма частина діаметра наночастинок, які інші люди намагаються доставити до кісткового мозку, - і це може принести велику користь,#сказав він. “Our self-delivering enzyme should be able to reach the bone marrow.”

Graphic representation of CRISPR-Cas9 repairing the mutation in the gene that causes sickle cell disease (shown in light blue). (UC Berkeley image courtesy of Innovative Genomics Institute)

Whatever the successful strategy, either ex vivo or in vivo, the CRISPR platform developed for sickle cell disease could transform gene therapy for other diseases.

“That is the IGI vision: first sickle cell, but our efforts will have a ripple effect to enable cures for blood disorders in general, like beta thalassemia, as well as diseases of the immune system,” he said. “The hematopoietic stem cell is the seed for the entire immune system, so all blood disorders can theoretically be cured by a stem cell therapy like this.”


Довідка

The domain of chicken beta-globin genes is located on chromosome 1 and has a length of approximately 33 kb. It includes a cluster of four beta-globin genes: ρ (HBG1), β H (HBE1), β А. (HBG2) і Ε (HBE) and several distant regulatory regions, which are marked with sites of hypersensitivity to DNase I (HS) and are necessary for the regulation of transcription, replication and chromatin status of the domain[1, 2]. The locus control region of the domain (LCR) is located upstream of the embryonic β-globin gene ρ and is composed of three blocks co-localizing with the erythroid cell-specific HSs 1 to 3[3, 4]. A constitutive HS4 located upstream of the LCR marks the position of the well-studied CTCF-dependent (CTCF ‐ СССTC-binding protein factor) insulator[5–9]. The CTCF-dependent enhancer-blocking element is also located at the downstream end of the domain in the area marked by the so-called 3′ constitutive HS[10, 11]. In addition to the LCR, the domain also possesses an internal enhancer (β/Ε-enhancer), which is located between the genes β A та Ε and is believed to contribute to the control of the activity of both genes[12–14]. The partitioning of tasks between the LCR and the β/Ε-enhancer is not quite clear. The results of experiments with transgenic mice carrying the chicken β-globin gene domain[4] suggested that the expression of one of the embryonic genes (ρ) is controlled by the LCR, while the expression of the other embryonic gene (Ε) is controlled by the β/Ε-enhancer. In addition, both regulatory elements appeared to be necessary for the correct developmental expression of the adult β-globin genes[3]. The domain of the chicken β-globin gene represents one of the best-studied genomic areas in higher eukaryotes[15]. This domain possesses all of the characteristic features of the so-called closed or strong chromatin domains[16, 17], which change the pattern of sensitivity to DNase I in a cell lineage-specific fashion. Detailed studies of the distribution of different histone modifications along the domain have contributed much to the present knowledge about the histone code[18, 19]. Nevertheless, the mechanisms of transcriptional switching of chicken β-globin gene expression remain poorly understood[15]. The developmental switching of globin gene transcription is typical for all vertebrate organisms[2]. In chickens, the first molecules of hemaglobin appear in embryonic erythroblasts 32 h after fertilization[20]. The beta-chains of the hemaglobin represent the products of genes ρ та Ε, which are transcribed from the 2 nd to the 5 th day of the embryonic development. After the 5 th day a new population of erythroid cells expressing the genes of fetal and adult globins β Н та β A з'являється. These cells gradually replace the embryonic-type erythroblasts that express genes 1ρ та Ε[21]. In erythroblasts of adult lineage, the transcription of embryonic β-type globin genes is repressed.

Analysis of β-globin mRNA levels in chicken 3-day and 9-day embryonic red blood cells. The vertical axis shows the relative amounts of β-globin gene primary transcripts, as determined by RT-qPCR analysis of RNA samples prepared from the blood of 3- and 9-day old chicken embryos. (А) Normalization of data to the level of β-actin mRNA. (В) Normalization of data to the amount of cells used for RNA preparation. The amounts of β-globin gene transcripts detected in different RNA samples were normalized to the number of cells used for preparation of these RNA samples. The amount of the most abundant transcript (ρ-transcript in 3-day RBCs) was set as 100 relative units and the other data were normalized to this value. The error bars represent the S.E.M. for two independent experiments.

Recent studies of the spatial configuration of the mouse and human β-globin gene domain suggest that in erythroid cells, all regulatory elements of the domain become assembled into a common activation complex (the ACH) where the promoters of different globin genes are recruited in a developmental stage-specific fashion[22–24].

In the present work, we have analyzed the spatial configuration of the chicken β-globin gene domain in circulating red blood cells (RBCs) both before (3-day RBCs) and after (9-day RBCs) the β-globin switching. Using the quantitative chromosome conformation capture assay (3C-qPCR)[25, 26], we have demonstrated that the switching of chicken β-globin gene expression correlates with prominent changes in the spatial configuration of the domain. However, the observed spectrum of changes does not perfectly fit the simplistic model that postulates that only the transcriptionally active genes are recruited to the ACH.


Матеріали та методи

Production of ivt mRNA

PCR DNA fragments with a modified T7 promoter sequence (TAA TAC GAC TCA CTA TAA GG) and an eiF4G aptamer (ACT CAC TAT TTG TTT TCG CGC CCA GTT GCA AAA AGT GTC G) followed by a codon- optimized firefly luciferase-coding gene (a synthetic gene purchased from Blue Heron Bio) or ZsGreen gene (Clontech) and terminated by either the sequence TAA or 5’ GAGAGCTCGCTTTCTTGCTG 3’ or a tandem repeat of the beta-globin 3’ UTR 14 were used as matrices for mRNA production with a HiScribe™ T7 mRNA Kit (New England Biolabs). The nucleotide mixture consisted of 8 mM CleanCapTM (a newly available CAP1 analogue), ATP, GTP, either CTP or 5mCTP and either UTP or N1-methyl pseudouridine (1) triphosphate (all from TriLink) at a final volume of 20 microlitres.

After incubation for 3 hours at 37°C, 80 microlitres of a solution containing 10 microlitres of 10x buffer, 3 microlitres of poly (A) polymerase, 1 microlitre of DNase and 1 microlitre of RNasin (all from New England Biolabs) were added. The reaction was incubated for 3 hours before the addition of 50 microlitres of 8M LiCl, cooling at -20°C for 30 minutes and centrifugation at 15000 rpm for 15 minutes. Supernatants were removed, and 200 microlitres of 75% ethanol was added. After a 10 minute centrifugation at 15000 rpm, the supernatants were discarded, and the RNA pellets were dried in a “Speed-Vac”. RNAs were then resuspended in water, and the concentration measured using a Nanodrop was adjusted to 1 microgram per microlitre. Quality and integrity of ivt mRNAs were checked using agarose gel electrophoresis. The RNAs were stored at -20°C.

Cells and Transfection

Human embryonic kidney (HEK) cells and CT26 mouse colon carcinoma cells were maintained in RPMI medium (Thermo Fisher Scientific) containing 10% foetal calf serum (FCS) and 0.2% antimicrobial reagent Normocin (InvivoGen). Human peripheral mononuclear blood cells (PBMCs) and mouse splenocytes were obtained from peripheral blood from healthy donors and wild type C57Bl/6 or BALB/c mice, respectively, using centrifugation with Ficoll. For Luciferase experiments, transfection of tumour cells (CT26 or HEK) was performed with 100 000 tumour cells per well in 100 microlitres of RPMI medium supplemented with 10% FCS and 0.2% antimicrobial reagent Normocin (Invivogen) by adding a mixture of 20 ng of mRNA in 0.5 microlitres of Opti- MEM (Thermo Fisher Scientific) and 40 ng of the lipofectamine transfection reagent MessengerMAX (Thermo Fisher Scientific) in 0.5 microlitres of Opti-MEM to each well.

Transfection of non-transformed cells (PBMCs or splenocytes) was performed with 1 million cells per well in 100 microlitres of RPMI medium supplemented with 10% FCS and 0.2% antimicrobial reagent Normocin (Invivogen) by adding a mixture of 200 ng of mRNA in 5 microlitres of Opti-MEM and 400 ng of MessengerMAX in 5 microlitres of Opti-MEM to each well. Luciferase activity was recorded one day after transfection by adding 25 microlitres of Bright-Glo luciferase assay solution (Promega) and measuring activity using GloMax luminometer equipment (Promega). For ZsGreen experiments, transfection of tumour cells (CT26 or HEK) was performed with 100 000 tumour cells per well in 200 microlitres of RPMI medium supplemented with 10% FCS and 0.2% antimicrobial reagent Normocin (Invivogen) by adding a mixture of 100 ng of mRNA in 2.5 microlitres of Opti-MEM (Thermo Fisher Scientific) and 200 ng of the lipofectamine transfection reagent MessengerMAX (Thermo Fisher Scientific) in 2.5 microlitres of Opti-MEM to each well. Fluorescence (Excitation: 485nm Emission: 528nm) was recorded in real time at 37°C using Cytation™ 3 Cell Imaging Multi-Mode Reader (BioTek). Immunostimulation experiments were performed by forming protamine-RNA nanoparticles as previously described 15 (mixing RNA at 0.5 mg/ ml in water with protamine at 0.5 mg/ml in water) and incubating them with PBMCs for 20 hours at a final RNA concentration of 5 microgram/ml. Then, the interferon-alpha and tumour necrosis factor (TNF)-alpha contents in the cell culture supernatants were recorded using ELISAs (from Mabtech and eBioscience, respectively).

Animals and в природних умовах Imaging

Our study “Anti-cancer therapies based on RNA” was approved by the Veterinary Office of the University of Zurich (Kanton Zürich, Health Direction, Veterinary Office, Zollstrasse 20 8090 Zurich license number ZH215/17). The Veterinary Office of the University of Zurich has a research ethics review committee that granted approval. All efforts were made to minimize suffering. Animals were purchased from Envigo (Netherlands). Mice of 4 to 8 weeks of age were injected intra-venously with 1 microgram of mRNA formulated with a TransIT-mRNA transfection kit following the manufacturer’s suggestions (Mirus). Briefly, per mouse, 1 microgram of mRNA was diluted in 38 microlitres of Opti-MEM (Gibco) before the addition of 0.72 microlitres of “mRNA Boost Reagent”. After mixing, 1.12 microlitres of TransIT reagent was added. The solution was thoroughly homogenated and injected immediately. Five hours later, bioluminescence в природних умовах imaging was performed on an IVIS Lumina instrument (PerkinElmer). Immediately before the measurements, D-luciferin (Synchem) dissolved in PBS (15 mg/ml stock) and sterile filtered was injected (150 μg/g intraperitoneally). Emitted photons from live animals were quantified 10-20 minutes post luciferin injections, with an exposure time of 1 min. Regions of interest (ROI) were quantified for average radiance (photons s−1 cm−2 sr−1) (IVIS Living Image 3.2).


Посилання

1. Vinjamur DS, Bauer DE, Orkin SH. Recent progress in understanding and manipulating haemoglobin switching for theopathies. Br J Haematol. (2018) 180:630�. doi: 10.1111/bjh.15038

2. Wienert B, Martyn GE, Funnell APW, Quinlan KGR, Crossley M. Wake-up sleepy gene: reactivating fetal globin for β-hemoglobinopathies. Тенденції Genet. (2018) 34:927�. doi: 10.1016/j.tig.2018.09.004

3. Steinberg MH, Rodgers GP. HbA2: biology, clinical relevance and a possible target for ameliorating sickle cell disease. Br J Haematol. (2015) 170:781𠄷. doi: 10.1111/bjh.13570

4. Manchinu MF, Marongiu MF, Poddie D, Casu C, Latini V, Simbula M, et al. В природних умовах activation of the human δ-globin gene: the therapeutic potential in β-thalassemic mice. Haematologica. (2014) 99:76�. doi: 10.3324/haematol.2012.082768

5. Danjou F, Zoledziewska M, Sidore C, Steri M, Busonero F, Maschio A, et al. Genome-wide association analyses based on whole-genome sequencing in Sardinia provide insights into regulation of hemoglobin levels. Нат Женет. (2015) 47:1264�. doi: 10.1038/ng.3307

6. Borg J, Papadopoulos P, Georgitsi M, Gutiérrez L, Grech G, Fanis P, et al. Haploinsufficiency for the erythroid transcription factor KLF1 causes hereditary persistence of fetal hemoglobin. Нат Женет. (2010) 42:801𠄵. doi: 10.1038/ng.630

7. Tallack MR, Perkins AC. Three fingers on the switch: krüppel-like factor 1 regulation of γ-globin to β-globin gene switching. Curr Opin Hematol. (2013) 20:193�. doi: 10.1097/MOH.0b013e32835f59ba

8. Wienert B, Martyn GE, Kurita R, Nakamura Y, Quinlan KGR, Crossley M. KLF1 drives the expression of fetal hemoglobin in British HPFH. Кров. (2017) 130:803𠄷. doi: 10.1182/blood-2017-02-767400

9. Perseu L, Satta S, Moi P, Demartis FR, Manunza L, Sollaino MC, et al. KLF1 gene mutations cause borderline HbA(2). Кров. (2011) 118:4454𠄸. doi: 10.1182/blood-2011-04-345736

10. Porcu S, Manchinu MF, Marongiu MF, Sogos V, Poddie D, Asunis I, et al. Klf1 affects DNase II-alpha expression in the central macrophage of a fetal liver erythroblastic island: a non-cell-autonomous role in definitive erythropoiesis. Mol Cell Biol. (2011) 31:4144�. doi: 10.1128/MCB.05532-11

11. Keyel PA. Dnases in health and disease. Dev Biol. (2017) 429:1�. doi: 10.1016/j.ydbio.2017.06.028

12. Yoshida H, Okabe Y, Kawane K, Fukuyama H, Nagata S. Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA. Nat Immunol. (2005) 6:49�.

13. Strouboulis J, Dillon N, Grosveld F. Developmental regulation of a complete 70-kb human beta-globin locus in transgenic mice. Genes Dev. (1992) 6:1857�. doi: 10.1101/gad.6.10.1857

14. Weatherall DJ. The inherited diseases of hemoglobin are an emerging global health burden. Кров. (2010) 115:4331𠄶. doi: 10.1182/blood-2010-01-251348

15. Thompson AA, Walters MC, Kwiatkowski J, Rasko JEJ, Ribeil JA, Hongeng S, et al. Gene therapy in patients with transfusion-dependent β-thalassemia. N Engl J Med. (2018) 378:1479�. doi: 10.1056/NEJMoa1705342

16. Cavazzana M, Mavilio F. Gene therapy for hemoglobinopathies. Hum Gene Ther. (2018) 29:1106�. doi: 10.1089/hum.2018.122

17. Modell B, Darlison M. Global epidemiology of haemoglobin disorders and derived services indicators. Bull World Health Organ. (2008) 86:480𠄷. doi: 10.2471/blt.06.036673

18. Piel FB, Hay SI, Gupta S, Weatherall DJ, Williams TN. Global burden of sickle cell anaemia in children under five, 2010-2050: modelling based on demographics, excess mortality, and interventions. PLoS Med. (2013) 10:e1001484. doi: 10.1371/journal.pmed.1001484

19. Origa R. β-Thalassemia. Genet Med. (2017) 19:609�. doi: 10.1038/gim.2016.173

20. Fibach E, Manor D, Oppenheim A, Rachmilewitz EA. Proliferation and maturation of human erythroid progenitors in liquid culture. Кров. (1989) 73:100𠄳.

21. Pope SH, Fibach E, Sun J, Chin K, Rodgers GP. Two-phase liquid culture system models normal human adult erythropoiesis at the molecular level. Eur J Haematol. (2000) 64:292�. doi: 10.1034/j.16000609.2000.90032.x

22. Menzel S, Garner C, Rooks H, Spector TD, Thein SL. HbA2 Levels in normal adults are influenced by two distinct mechanisms. Br J Haematol. (2013) 160:101𠄵. doi: 10.1111/bjh.12084

23. Socolovsky M, Murrell M, Liu Y, Pop R, Porpiglia E, Levchenko A. Negative autoregulation by FAS mediates robust fetal erythropoiesis. PLoS Biol. (2007) 5:e252. doi: 10.1371/journal.pbio.0050252

24. Ribeil JA, Arlet JB, Dussiot M, Moura IC, Courtois G, Hermine O. Ineffective erythropoiesis in β-thalassemia. Sci World J. (2013) 2013:394295. doi: 10.1155/2013/394295

25. Gupta R, Musallam KM, Taher AT, Rivella S. Ineffective erythropoiesis: anemia and iron overload. Hematol Oncol Clin North Am. (2018) 32:213�. doi: 10.1016/j.hoc.2017.11.009

26. Ozcan ME, Ince B, Karadeli HH, Gedikbasi A, Asil T, Altinoz MA. Higher minor hemoglobin A2 levels in multiple sclerosis patients correlate with lesser disease severity. Neuropsychiatr Dis Treat. (2016) 1612:2033𠄸. doi: 10.2147/NDT.S109954

27. Palstra RJ, de Laat W, Grosveld F. Beta-globin regulation and long-range interactions. Adv Genet. (2008) 61:107�. doi: 10.1016/S0065-2660(07)00004-1

28. Ross J, Pizarro A. Human beta and delta globin messenger rnas turn over at different rates. J Mol Biol. (1983) 167:607�.

29. Runkel L, Meier W, Pepinsky RB, Karpusas M, Whitty A, Kimball K, et al. Structural and functional differences between glycosylated and non-glycosylated forms of human interferon-beta (IFN-beta). Pharm Res. (1998) 15:641𠄹.

30. Durelli L, Verdun E, Barbero P, Bergui M, Versino E, Ghezzi A, et al. Every-other-day interferon beta-1b versus once-weekly interferon beta-1a for multiple sclerosis: results of a 2-year prospective randomised multicentre study (INCOMIN). Lancet. (2002) 359:1453�. doi: 10.1016/s0140-6736(02)08430-1

31. Rodero MP, Tesser A, Bartok E, Rice GI, Della Mina E, Depp M, et al. Type I interferon-mediated autoinflammation due to DNase II deficiency. Nat Commun. (2017) 8:2176. doi: 10.1038/s41467-017-01932-3

32. Paikari A, Sheehan VA. Fetal haemoglobin induction in sickle cell disease. Br J Haematol. (2018) 180:189�. doi: 10.1111/bjh.15021

33. Ristaldi MS, Casula S, Porcu S, Marongiu MF, Pirastu M, Cao A. Activation of the delta-globin gene by the beta-globin gene CACCC motif. Blood Cells Mol Dis. (1999) 25:193�.

34. Powars DR, Weiss JN, Chan LS, Schroeder WA. Is there a threshold level of fetal hemoglobin that ameliorates morbidity in sickle cell anemia?. Кров. (1984) 63:921𠄶.

35. Estepp JH, Smeltzer MP, Kang G, Mstats CL, Wang WC, Abrams C, et al. A clinically meaningful fetal hemoglobin threshold for children with sickle cell anemia during hydroxyurea therapy. Am J Hematol. (2017) 92:1333𠄹. doi: 10.1002/ajh.24906

36. Testa U. Apoptotic mechanisms in the control of erythropoiesis. Leukemia. (2004) 18:1176-99. doi: 10.1038/sj.leu.2403383

37. Sarvothaman S, Undi RB, Pasupuleti SR, Gutti U, Gutti RK. Apoptosis: role in myeloid cell development. Blood Res. (2015) 50:73𠄹. doi: 10.5045/br.2015.50.2.73

38. Manchinu MF, Brancia C, Caria CA, Musu E, Porcu S, Simbula M, et al. Deficiency in interferon type 1 receptor improves definitive erythropoiesis in Klf1 null mice. Cell Death Differ. (2018) 25:589�. doi: 10.1038/s41418-017-0003-5

39. Means RT Jr, Krantz SB. Inhibition of human erythroid colony-forming units by tumor necrosis factor requires beta interferon. J Clin Invest. (1993) 91:416𠄹.

40. Means RT Jr, Krantz SB. Inhibition of human erythroid colony-forming units by interferons alpha and beta: differing mechanisms despite shared receptor. Exp Hematol. (1996) 24:204𠄸.

41. Sankaran VG, Ludwig LS, Sicinska E, Xu J, Bauer DE, Eng JC, et al. Cyclin D3 coordinates the cell cycle during differentiation to regulate erythrocyte size and number. Genes Dev. (2012) 26:2075�. doi: 10.1101/gad.197020

Keywords: erythropoiesis, δ-globin gene, interferon type 1, beta thalassemia, sickle cell anemia

Citation: Manchinu MF, Simbula M, Caria CA, Musu E, Perseu L, Porcu S, Steri M, Poddie D, Frau J, Cocco E, Manunza L, Barella S and Ristaldi MS (2020) Delta-Globin Gene Expression Is Enhanced в природних умовах by Interferon Type I. Фронт. Мед. 7:163. doi: 10.3389/fmed.2020.00163

Received: 28 January 2020 Accepted: 09 April 2020
Published: 22 May 2020.

Richard Van Wijk, Utrecht University, Netherlands

Cornelis Harteveld, Leiden University Medical Center, Netherlands
Emile Van Den Akker, Sanquin Diagnostic Services, Netherlands

Copyright © 2020 Manchinu, Simbula, Caria, Musu, Perseu, Porcu, Steri, Poddie, Frau, Cocco, Manunza, Barella and Ristaldi. Це стаття з відкритим доступом, яка розповсюджується на умовах Ліцензії атрибуції Creative Commons (CC BY). Використання, розповсюдження або відтворення на інших форумах дозволено за умови зарахування первинного автора (авторів) та власника (-ів) авторських прав та цитування оригінальної публікації у цьому журналі відповідно до прийнятої академічної практики. Не допускається використання, розповсюдження чи відтворення, що не відповідає цим умовам.